Logo Lanfrica
  • Home
  • Atlas
  • Insights
  • Docs
  • Sign in

© 2026 Lanfrica. All rights reserved. All copyrights of the resources shown on the Lanfrica website belong to the original copyright holders, unless explicitly stated otherwise.

RNA sequences for Aedes species, Dengue, and Chikungunya viruses

Domain:

healthcare

Record type:

dataset
Creator:
Nga
Publisher:
Dry
Host:avatar
There are arthropod-borne disease outbreaks as a result of pathogen influx including arboviruses which are transmitted by strains of Aedes species that occur periodically in varying spots on the globe. The aim of this study was to determine phylogenetic relationship of Aedes mosquitoes, Dengue, and Chikungunya viruses along the Coastline of Kenya based on sequences of: mitochondria nicotinamide adenine dehydrogenase sub unit 4 gene for Aedes species. non-structural protein 5 gene for Dengue virus non-structural protein 1 gene for Chikungunya virus Sample collection: Indoor and outdoor sampling of adults Aedes mosquitoes was done using Biogent Sentinel trap baited with solid carbon dioxide and Prokopack aspiration technique. RNA extraction and cDNA synthesis Pools of Aedes mosquitoes (20 mosquitoes per pool) were homogenized by a mortar and pestle and RNA extracted using 1 ml of Trizol® as earlier described. Only the unfed and gravid mosquitoes were utilised in this analysis. The female blood-fed were excluded to avoid contamination of the virus which could be in the blood meal. cDNA synthesis was done on 10 μl of the extracted RNA to generate cDNA by using EcoDry Premix (Random hexamers) (Clontech laboratories, Inc., Mountain view, CA, USA) in a procedure described earlier. Molecular Identification and sequencing of Aedes mosquitoes and Viruses  The mtNAD4 gene was utilised for identification of Aedes mosquitoes using primers listed (Table 1) as earlier described. Identification of serotypes of Dengue virus in the Aedes mosquitoes was based on amplification of the target viral genes (E/NS1/NS5) in RNA using multiplex PCR with a panel of general flavivirus family primers (Table 2) as earlier described. Samples tested positive for flavivirus were further tested with consensus primers for Dengue virus. These primers were DEN-F and DEN-CR and they target the E/NS1 junction of the virus genome. Only samples tested positive with Dengue consensus primers were further tested for the four Dengue serotypes using appropriate primers (Table 3) as described. Identification of genotypes of Chikungunya virus was based on amplification of the target viral gene E1 in the RNA using multiplex PCR with AgPath-ID One-step RT-PCR kit (Applied bio systems, Carlsbad, Califonia, USA) using a panel of general alphaviruses primers (Table 2). Samples tested positive for alphavirus were further tested with conventional primers for Chikungunya virus (Table 4). The amplified gene products were cleaned from the gel by MinElute PCR purification kit (Qiagen, Valencia, CA) and sequenced using Sanger high-throughput technique. Sequence analysis: Generated nucleotide sequences were used for phylogenetic analysis. DNAbaser v.3.0 (dnabaser.com) was used for editing bad calls in the raw chromatogram file generated from sequencing the forward and reverse strands. Deletion of the generated sequences of primers was done from the 5’ and 3’ ends. The sequences were subjected to Basic Local Alignment Tool (BLASTn) and GenBank database to compare them with available sequences and confirm the identity of the isolates. Formatting of the retrieved sequences compatible with alignment programs and identification of correct reading frame for each sequence was done using the translation program at us.expasy.org. The sequences were aligned for identification and removal of duplicate sequences using Clustal Omega v1.2.1, scored in T-coffee (tcoffee.crg.cat) and viewed in jalview jalview.org (Sievers and Higgins, 2014). The sequences were manually adjusted in Se-Al software according to DNA sequence alignments for preservation of codon homology. Columns with more than one percent of gaps were removed from the alignment using trimAl v1.4.rev6. Using pmodeltest v1.4, Maximum likelihood trees were inferred using Randomised Accelerated Maximum Likelihood (RAxML) version 8.1.20 ran with model GTR+GAMMA+I for selecting the best-fit model for the maximum likelihood analyses and plotting of phylogenetic trees using interactive tree of life (itol.embl.de). Table 1: Primers used in identification of Aedes mosquitoes Target Primer name Nucleotide sequences (5’ to 3’) Polarity Product (bp) Mosquito RNA marker (UP) Act-2F ATGGTCGGYATGGGNCAGAAGGACTC Forward 683   Act-8R GATTCCATACCCAGGAAGGADGG Reverse   Ae. aegypti s.l 18SFHIN     CP16 GTAAGCTTCCTTTGTACACACCGCCCGT GCGGGTACCATGCTTAAATTTAGGGGT Forward 550   Aeg.r1 TAACGGACACCGTTCTAGGCCCT Reverse   Ae. tricholabis UV TGTGAACTGCAGGACACAT Forward   Ae. pembaensis PEM GCATCGATGGGTTAATCATG Reverse 405 Ae. ocharaceous OCH CAAGCCGTTCGACCCTGATT Reverse 501 Ae. albicosta ALB CCTGGCCAGTGGCCAAAT Reverse   Ae. fulgens FUL GTGCACACCACTGAATT Reverse   Ae. mcntoshi MCN CTGATGCACTGGCCTCAAAG Reverse   Ae. fryeri FRR TCAACCGCCGTGCGTG Reverse   ND4 ND4sb+ TGATTGCCTAAGGCTCATGT Forward 344   ND4sb- TTCGGCTTCCTAGTCGTTCAT Reverse     Table 2: Primers and probes for identification of flaviviruses and alpha viruses   Primers and Probes Sequence Tm o Flavivirus     Flavi allS (Forward Primer) 5’-TACAACATgATggggAARAgAgARAA-3’ 53.8 Flavi all AS2 (Reverse Primer) 5’-gTgTCCCAgCCNgCKgTgTCATCWgC-3’   Flavi all AS4 (Reserve Primer) 5’-gTgTCCCAGCCNgCKgTRTCRTC-3’ 80.4 3Pi (Probe) FAM-Tg+gTWYATgT+ggYTNg+gRgC-NFQ-MGB 50.3 3Pii (Probe) FAM-CCgTgCCATATggTATATgTggCTgggAgC-NFQ-MGB   3Piii (Probe) FAM-TTTCTggAATTTgAAgCCCTgggTTT-NFQ-MGB   Pan-alphavirus     F2A (Forward Primer) 5’- ATGATGAARTCIGGIATGTTYYT-3’   R2A (Reverse Primer) 5’-ATYTTIACTTCCATGTTCATCCA-3’   R3A (Reverse Primer) 5’-ATYTTIACTTCCATRTTCARCCA-3’   R4A (Reverse Primer) 5’-ATYTTIACTTCCATGTTGACCCA-3’   ATTO425 (Probe) - AT+GTT+GTC+GT+CIC+CIAT-BHQ1/LNA                                                       Table 3: Primers for identification of serotypes of Dengue virus Primer Gene/ protein target Primer sequence (5’ to 3’) Position FU1 NSP5 TACAACATGATGGGAAAGAGAGAGAA 9007-9032 CFD3 NSP5 GTGTCCCAGCCGGCGGTGTCATCAGC 9308-9283 DEN-F E/NS1 TCAATATGCTGAAACGCGCGAGAAACCG 38-65 DEN-CR E/ NS1 TTGCACCAACAGTCAATGTCTTCAGGTTC 455-483 TS1-R NSP5 CGTCTCAGTGATCCGGGGG (DEN-F and TS1)   TS2-R NSP5 CGCCACAAGGGCCATGAACAG (DEN-F and TS2)   TS3-R NSP5 TAACATCATCATGAGACAGAGC(DEN-F and TS3)   TS4-R NSP5 CTCTGTTGTCTTAAACAAGAGA(DEN-F and TS4)   D5-F NSP5 TCAATATGCTGAAACGCGHGAG 132-153 D5-R NSP5 GCGCCTTCNGNNGACATCCA 764-783     Table 4: Primers for identification of Chikungunya virus Primer Gene/ protein target Primer sequence (5’ to 3’) Position VIR 2052 F NSP4 TGGCGCTATGATGAAATCTGGAATGTT 6971-6997 VIR 2052R NSP4 TACGATGTTGTCGTCGCCGATGAA 7086–7109 CHIKV-F E1 CGTGGTGTACAAAGGTGACG 10524 CHIKV-R CHIKWa CHIKAs CHIKECSa E1 NSP1 NSP1 NSP1 ACG CCG GGTAGTTGACTATG GGCAAACGCAGTGGTACTTCCT GGCAGACGCAGTGGTACTTCCT TGATCCCGACTCAACCATCCT 11170 295-316 295-316 234-254  

Visit

doi.orgdatadryad.org

Languages

Fam

Tags

FOS: Medical and health sciencesFOS: Medical and health sciencesDengue virusChikungunya virusAedes mosquito

Licenses

Creative Commons Zero v1.0 Universalhttps://creativecommons.org/publicdomain/zero/1.0/legalcode

Similar

Intrinsic ability of cuban Aedes aedypti populations to transmit Dengue, Chikungunya and Zika virusesPrevalence of Dengue and Chikungunya viruses in north-eastern TanzaniaChikungunya (Togaviridae) and Dengue 2 (Flaviviridae) Viruses Isolated from Aedes aegypti Mosquitoes by qRT-PCR Technique: Xenosurveillance for Arboviruses Circulating in Burkina FasoDivergent climate suitability profiles for dengue and chikungunya transmission by Aedes albopictus in MauritiusConcurrent Infection With Dengue and Chikungunya Viruses in Humans and Mosquitoes: A Field Survey in Lower Moshi, TanzaniaGlobal genomics of Aedes aegypti unveils widespread and novel infectious viruses capable of triggering a small RNA response

Intrinsic ability of cuban Aedes aedypti populations to transmit Dengue, Chikungunya and Zika viruses

International audience

Prevalence of Dengue and Chikungunya viruses in north-eastern Tanzania

Chikungunya (Togaviridae) and Dengue 2 (Flaviviridae) Viruses Isolated from Aedes aegypti Mosquitoes by qRT-PCR Technique: Xenosurveillance for Arboviruses Circulating in Burkina Faso

Abstract: In 2016, we conducted an entomological survey in a railway transect between Banfora and Ou

Divergent climate suitability profiles for dengue and chikungunya transmission by Aedes albopictus in Mauritius

Background: Empirical surveillance for Aedes-borne arboviruses is inherently reactive, detecting tra

Concurrent Infection With Dengue and Chikungunya Viruses in Humans and Mosquitoes: A Field Survey in Lower Moshi, Tanzania

Introduction: Dengue and Chikungunya have re-emerged as important diseases of global concern. Co-inf

Global genomics of Aedes aegypti unveils widespread and novel infectious viruses capable of triggering a small RNA response

International audience The mosquito Aedes aegypti is a prominent vector for arbovirus